|
|
|
GeneBlocker pGB siRNA Vector Mix |
 |
|
| Cat. # | 9511-20 (20 µg), -60 (60 µg) GeneBlockerTM AIF siRNA Vector Mix
9512-20 (20 µg), -60 (60 µg) GeneBlockerTM BAD siRNA Vector Mix
9513-20 (20 µg), -60 (60 µg) GeneBlockerTM BAX siRNA Vector Mix
9514-20 (20 µg), -60 (60 µg) GeneBlockerTM Bcl-2 siRNA Vector Mix
9515-20 (20 µg), -60 (60 µg) GeneBlockerTM BID siRNA Vector Mix
9516-20 (20 µg), -60 (60 µg) GeneBlockerTM cIAP-1 siRNA Vector Mix
9517-20 (20 µg), -60 (60 µg) GeneBlockerTM cIAP-2 siRNA Vector Mix
9518-20 (20 µg), -60 (60 µg) GeneBlockerTM Hsp90 alpha siRNA Vector Mix
9500C-1 (GeneBlockerTM Negative Control siRNA Vector, pGB-Control)
9500-1 (GeneBlockerTM siRNA Cloning Vector, pGB) | | Introduction: | | Small interfering RNAs (siRNAs) are short, double-stranded RNA molecules that can target and degrade specific complementary mRNAs. The target gene-specific degradation is an effective means of gene suppression. Biolinkk's GeneBlockerTM pGB siRNA vectors are designed to provide efficient, long-term suppression of a target gene in cultured mammalian cells and in vivo. The pGB vectors have been optimized for suppressing expression of target genes using the human U6 promotor (a RNA polymerase III promotor) which generates large amounts of siRNA in mammalian cells. The pGB vectors also provide neomycin resistance marker for the selection of stable cell lines, permitting long-term suppression of the target gene. Biolinkk offers pGB siRNA vector mix which consists of 4 siRNA vectors for each gene targeted. pGB siRNA negative control vector and pGB cloning vector for cloning in your own insert are also available. | | Description of the Vectors: | | pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. In addition, pGB Cloning vector which is used to clone your own insert and pGB Negative Control vector which contains an insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and therefore can be used as a negative control for pGB-expression vectors. The pGB siRNA vectors are designed to suppress the expression of some of the most important apoptosis genes, individually. The mix of four siRNA vectors for each gene has been proven more efficient for gene suppression. | | Applications: | | The pGB siRNA vector Mix (1 µg/µl) can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked. |  | | Fig. 1. Schematic Diagram of the RNA Interference Mechanism. |  | | Fig. 2. GeneBlockerTM pGB Bcl-2 siRNA Vector Blocks Bcl-2 Expression in HeLa Cells. | | Bcl-2 siRNA Vector (pGB-Bcl-2) was transfected into HeLa cells using Lipofectmine (Invitrogen). PGB-Control Vector with a siRNA sequence that has no homology to mammalian gene was also transfected as a negative control. Western blot was probed with a Bcl-2 polyclonal antibody. | | pGB Vector Map |  | | pGE-1 Multiple Cloning Site Region |
| | Features and Positions: | | Human U6 Promoter: | 1 - 256 | | Multiple cloning Site: | 259 - 285 | | 3' Primer: | 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) | | SV40 Promoter: | 470 - 808 | | Neomycin/Kanamycin Resistance ORF: | 843 - 1634 | | 5' Primer: | 2789 - 2813 (CGTCGATTTTTGTGATGCTCGTCAG) | | pUC Origin of Replication: | 2222 - 3003 |
Related Products:
Apoptosis Detection Kits & Reagents Annexin V Kits & Bulk Reagents Caspase Assay Kits & Reagents Mitochondrial Apoptosis Kits & Reagents Nuclear Apoptosis Kits & Reagents Apoptosis Inducers & Inhibitors Apoptosis Isolation Kits
Cell Fractionation System Mitochondria/Cytosol Fractionation Kit Nuclear/Cytosol Fractionation Kit Membrane Protein Extraction Kit Cytosol/Particulate Rapid Separation Kit Mammalian Cell Extraction Kit FractionPREP Fractionation System
Cell Proliferation & Senescence Quick Cell Proliferation Assay Kit Senescence Detection Kit High Throughput Apoptosis/Cell Viability Assay Kits LDH-Cytotoxicity Assay Kit Bioluminescence Cytotoxicity Assay Kit Live/Dead Cell Staining Kit
Cell Damage & Repair HDAC Fluorometric & Colorimetric Assays & Drug Discovery Kits HAT Colorimetric Assay Kit & Reagents DNA Damage Quantification Kit Glutathione Fluorometric & Colorimetric Assay Kits Nitric Oxide Fluorometric & Colorimetric Assay Kits
Signal Transduction Adipocyte & Lipid Transfer Recombinant Adiponectin, Survivin, & Leptin CETP Activity Assay & Drug Discovery Kits Total Cholesterol Quantification Kit
Molecular Biology & Reporter Assays siRNA Vectors Cloning Insert Quick Screening Kit Mitochondrial & Genomic DNA Isolation Kits 5 Minutes DNA Ligation Kit 20 Minutes Gel Staining/Destaining Kits
Antibodies & Recombinant Proteins (many)
|
GeneBlocker, RNA polymerase, pGB Cloning vector, pGB Negative Control vector, Human U6 Promoter, SV40 Promoter, Cytosol Fractionation Kit, DNA Ligation Kit, Genomic DNA Isolation Kits, Cloning Insert Quick Screening Kit, Total Cholesterol Quantification Kit, Drug Discovery Kits, Colorimetric Assay Kits, DNA Damage Quantification Kit, HAT Colorimetric Assay Kit
|
|
|
|
247
